Dinucleotide repeat polymorphism at the SIS locus

H. Patterson; P. J. Mitchell; C. S. Cooper; M. R. Stratton

doi:10.1093/nar/18.19.5917-a

Dinucleotide repeat polymorphism at the SIS locus

H. Patterson, P. J. Mitchell, C. S. Cooper, M. R. Stratton

Research output: Contribution to journal › Article › peer-review

6 Citations (Scopus)

Original language	English
Pages (from-to)	5917
Number of pages	1
Journal	Nucleic Acids Research
Volume	18
Issue number	19
DOIs	https://doi.org/10.1093/nar/18.19.5917-a
Publication status	Published - 11 Oct 1990

Access to Document

10.1093/nar/18.19.5917-a

Cite this

@article{d73eca9671a34f12a993ab5efcec463f,

title = "Dinucleotide repeat polymorphism at the SIS locus",

author = "H. Patterson and Mitchell, {P. J.} and Cooper, {C. S.} and Stratton, {M. R.}",

note = "Funding Information: Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an important new pool of genetic markers. Using the polymerase chain reaction and primers flanking the (G-T)n region, one of which is end-labelled with y^P dATP, these polymorphic alleles can be amplified and distinguished by electrophoresis in polyacrylamide gels. Primer Sequences: AGAGGTGAATTTGCAAGTGA (GT strand); AGTGATGGTTATTACTGCAG (CA strand). PCR Conditions: PCR was carried out in a total volume of 100 /J containing 1 fig genomic DNA; 25 pmols of each primer with an additional 0.2 pmol of radiolabelled CA strand primer; 400 fM of each dNTP's; 50 mM KC1, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 0.01% w/v gelatin; 2 units Taq polymerase (Cetus). Each amplification was performed for 30 cycles, 1 minute at 93°C, 1 minute at 57°C and 1 minute at 72°C. Polymorphism: PCR detects five alleles. Sequencing of two subcloned alleles revealed that the variation in size results from changes in the length of the (G-T)n region and of an adjacent (G-C)nregion. Allele Al (G-T)l2 (G-C)4 (G-A^Allele A4 (G-T)17 (G-C)4C (G-A)2 Chromosomal Localization: 4.7 kb upstream of the 'TATA' box of the c-sis proto-oncogene on chromosome 22 (1). Frequency: Allele frequencies were calculated from 28 unrelated individuals. Mendelian Inheritance: Codominant segregation was shown in 1 informative two generation family (14 individuals). AlWc Allele (bp) Frequency Al 85 064 A2 87 007 A3 89 004 A4 96 030 A3 98 003 He»crozygo*lly in our simple - 57%. Acknowledgements: We thank Bruce Ponder for DNA samples. This work was supported by grants from the Cancer Research Campaign and the Medical Research Council. References: 1) Van den Ouweland.A.M.W., van Groningen.J.J.M., Hendricksen.P.J.M., Bloemers.H.P.J. and Van de Ven,W.J.M. (1987) Nucl. Acids Res. 15,4349. 2) Litt.M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Funding Information: Acknowledgements: We thank R.Cortese for providing a prothrombin partial cDNA clone. Supported in part by Sanofi B.V.",

year = "1990",

month = oct,

day = "11",

doi = "10.1093/nar/18.19.5917-a",

language = "English",

volume = "18",

pages = "5917",

journal = "Nucleic Acids Research",

issn = "0305-1048",

publisher = "Oxford University Press",

number = "19",

}

TY - JOUR

T1 - Dinucleotide repeat polymorphism at the SIS locus

AU - Patterson, H.

AU - Mitchell, P. J.

AU - Cooper, C. S.

AU - Stratton, M. R.

N1 - Funding Information: Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an important new pool of genetic markers. Using the polymerase chain reaction and primers flanking the (G-T)n region, one of which is end-labelled with y^P dATP, these polymorphic alleles can be amplified and distinguished by electrophoresis in polyacrylamide gels. Primer Sequences: AGAGGTGAATTTGCAAGTGA (GT strand); AGTGATGGTTATTACTGCAG (CA strand). PCR Conditions: PCR was carried out in a total volume of 100 /J containing 1 fig genomic DNA; 25 pmols of each primer with an additional 0.2 pmol of radiolabelled CA strand primer; 400 fM of each dNTP's; 50 mM KC1, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 0.01% w/v gelatin; 2 units Taq polymerase (Cetus). Each amplification was performed for 30 cycles, 1 minute at 93°C, 1 minute at 57°C and 1 minute at 72°C. Polymorphism: PCR detects five alleles. Sequencing of two subcloned alleles revealed that the variation in size results from changes in the length of the (G-T)n region and of an adjacent (G-C)nregion. Allele Al (G-T)l2 (G-C)4 (G-A^Allele A4 (G-T)17 (G-C)4C (G-A)2 Chromosomal Localization: 4.7 kb upstream of the 'TATA' box of the c-sis proto-oncogene on chromosome 22 (1). Frequency: Allele frequencies were calculated from 28 unrelated individuals. Mendelian Inheritance: Codominant segregation was shown in 1 informative two generation family (14 individuals). AlWc Allele (bp) Frequency Al 85 064 A2 87 007 A3 89 004 A4 96 030 A3 98 003 He»crozygo*lly in our simple - 57%. Acknowledgements: We thank Bruce Ponder for DNA samples. This work was supported by grants from the Cancer Research Campaign and the Medical Research Council. References: 1) Van den Ouweland.A.M.W., van Groningen.J.J.M., Hendricksen.P.J.M., Bloemers.H.P.J. and Van de Ven,W.J.M. (1987) Nucl. Acids Res. 15,4349. 2) Litt.M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Funding Information: Acknowledgements: We thank R.Cortese for providing a prothrombin partial cDNA clone. Supported in part by Sanofi B.V.

PY - 1990/10/11

Y1 - 1990/10/11

UR - http://www.scopus.com/inward/record.url?scp=0025107896&partnerID=8YFLogxK

U2 - 10.1093/nar/18.19.5917-a

DO - 10.1093/nar/18.19.5917-a

M3 - Article

C2 - 2216802

AN - SCOPUS:0025107896

VL - 18

SP - 5917

JO - Nucleic Acids Research

JF - Nucleic Acids Research

SN - 0305-1048

IS - 19

ER -

Dinucleotide repeat polymorphism at the SIS locus

Access to Document

Other files and links

Cite this