Abstract
The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Original language | English |
---|---|
Pages (from-to) | 128-32 |
Number of pages | 5 |
Journal | Biochemical and Biophysical Research Communications |
Volume | 447 |
Issue number | 1 |
DOIs | |
Publication status | Published - 25 Apr 2014 |
Keywords
- G-quadruplex
- Nrf2
- 9-Aminoacridine
- Inflammation
- Cancer
Profiles
-
Maria O'Connell
- School of Pharmacy - Professor of Cell Biology
- Molecular and Tissue Pharmacology - Group Lead
Person: Research Group Member, Academic, Teaching & Research
-
Mark Searcey
- School of Pharmacy - Pro-Vice-Chancellor
- Norwich Institute for Healthy Aging - Member
Person: Research Centre Member, Academic, Teaching & Research